| Index | Recent Threads | Unanswered Threads | Who's Active | Guidelines | Search |
| World Community Grid Forums
|
| No member browsing this thread |
|
Thread Status: Active Total posts in this thread: 148
|
|
| Author |
|
|
seippel
Former World Community Grid Tech Joined: Apr 16, 2009 Post Count: 392 Status: Offline Project Badges:
|
Mamajuanauk: Does your graphics window only display the progress bar and a number counting up or does the window close almost immediately after you click 'show graphics'? If it closes immediately, it may be related a bug with the boinc api that reported in a different thread a couple of months ago. As a work around, you can launch the boinc gui as a user who is in the boinc group (show graphics for MCM1 behaves the same way).
Seippel |
||
|
|
Crystal Pellet
Veteran Cruncher Joined: May 21, 2008 Post Count: 1403 Status: Offline Project Badges:
|
There is no date I can share with you unfortunately. As usual with most projects we attempt to keep the launch date private. Thanks, -Uplinger But the subject of the project you may share. It's not hard to guess seeing passing by all those sequences, that it will be a gene or protein project. atgaaaaaatttaatgttcaaatcacatacactggcatgattgaagagactatcgaggctgaaagtttagacgaagcagaaaatgaggcgcatgatattg cgagaatggaagtgccatttgattgtgatgagtatgaaatttatgtagatgtggagcaggaaaatgactaa |
||
|
|
Mamajuanauk
Master Cruncher United Kingdom Joined: Dec 15, 2012 Post Count: 1900 Status: Offline Project Badges:
|
Mamajuanauk: Does your graphics window only display the progress bar and a number counting up or does the window close almost immediately after you click 'show graphics'? If it closes immediately, it may be related a bug with the boinc api that reported in a different thread a couple of months ago. As a work around, you can launch the boinc gui as a user who is in the boinc group (show graphics for MCM1 behaves the same way). Nothing comes up, no window at all...Seippel However, this is on a server with a basic onboard gpu, so that may have something to do with it... (Boinc 7.0.27) On a different machine running Ubuntu 14.xx (desktop) Boinc 7.2.42 the window opens then closes immediately I checked on my Windows machine, it does display the window with only the counter bar and WCG logo.
Mamajuanauk is the Name! Crunching is the Game!
![]() ![]() |
||
|
|
Crystal Pellet
Veteran Cruncher Joined: May 21, 2008 Post Count: 1403 Status: Offline Project Badges:
|
Meanwhile most of my BETA's returned without issues.
Only the tasks of the 00032-batch are still in progress with longer runtimes of ~8-9 hours. The maximum result.tmp I observed was 6,957,830 bytes and upload files between 250-270kB. |
||
|
|
Former Member
Cruncher Joined: May 22, 2018 Post Count: 0 Status: Offline |
I'm running Ubuntu 14.04 LTS Desktop code on an IBM 3650 M2 server with Boinc client 7.4.12 and it works OK.. Get black screen with logo at the bottom and white progress bar.
----------------------------------------[Edit 1 times, last edit by Doneske at Oct 11, 2014 9:24:13 PM] |
||
|
|
uplinger
Former World Community Grid Tech Joined: May 23, 2005 Post Count: 3952 Status: Offline Project Badges:
|
We are sending out a random sampling from about 50 batches for this beta. There will be 5,700 work units sent out with a quorum of two. No update to the science application is needed for this test, as it is to help check the estimator.
Thanks, -Uplinger |
||
|
|
Falconet
Master Cruncher Portugal Joined: Mar 9, 2009 Post Count: 3315 Status: Offline Project Badges:
|
Got 4 of the new ones.
----------------------------------------Going really fast, some at 10% after 1 and a half CPU minute. ![]() - AMD Ryzen 5 1600AF 6C/12T 3.2 GHz - 85W - AMD Ryzen 5 2500U 4C/8T 2.0 GHz - 28W - AMD Ryzen 7 7730U 8C/16T 3.0 GHz [Edit 1 times, last edit by Falconet at Oct 12, 2014 7:32:13 PM] |
||
|
|
vepaul
Senior Cruncher Belgium Joined: Nov 17, 2004 Post Count: 261 Status: Offline Project Badges:
|
Mine look fine, all of about the same length
BETA_ ugm1_ ugm1_ 00031_ 1161_ 0-- 722 Valide 11/10/14 14:40:09 11/10/14 20:01:21 3,01 90,4 / 80,6 BETA_ ugm1_ ugm1_ 00031_ 1161_ 1-- 722 Valide 11/10/14 14:40:08 11/10/14 22:51:20 5,33 70,8 / 80,6 VEP |
||
|
|
Crystal Pellet
Veteran Cruncher Joined: May 21, 2008 Post Count: 1403 Status: Offline Project Badges:
|
All tasks received where BOINC-data is on a RAM-disk, crash directly after the start.
CEP2's are running fine from that folder. ERROR: could not initialize graphics pointer in shared memory. BETA_ betaugm1_ ugm1_ 00036_ 0303_ 0-- 3166874 Error 10/12/14 20:12:16 10/12/14 20:13:37 0.00 / 0.00 0.0 / 0.0 BETA_ betaugm1_ ugm1_ 00036_ 0291_ 0-- 3166874 Error 10/12/14 20:12:16 10/12/14 20:13:37 0.00 / 0.00 0.0 / 0.0 BETA_ betaugm1_ ugm1_ 00036_ 0219_ 0-- 3166874 Error 10/12/14 20:12:16 10/12/14 20:13:37 0.00 / 0.00 0.0 / 0.0 BETA_ betaugm1_ ugm1_ 00036_ 0147_ 1-- 3166874 Error 10/12/14 20:12:16 10/12/14 20:13:37 0.00 / 0.00 0.0 / 0.0 BETA_ betaugm1_ ugm1_ 00032_ 0601_ 1-- 3166874 Error 10/12/14 19:51:07 10/12/14 19:56:34 0.00 / 0.00 0.0 / 0.0 |
||
|
|
KWSN - A Shrubbery
Master Cruncher Joined: Jan 8, 2006 Post Count: 1585 Status: Offline |
Looking good. Already returned some of the faster ones.
----------------------------------------![]() Distributed computing volunteer since September 27, 2000 |
||
|
|
|