Index  | Recent Threads  | Unanswered Threads  | Who's Active  | Guidelines  | Search
 

Quick Go ยป
No member browsing this thread
Thread Status: Active
Total posts in this thread: 148
Posts: 148   Pages: 15   [ Previous Page | 4 5 6 7 8 9 10 11 12 13 | Next Page ]
[ Jump to Last Post ]
Post new Thread
Author
Previous Thread This topic has been viewed 17453 times and has 147 replies Next Thread
seippel
Former World Community Grid Tech
Joined: Apr 16, 2009
Post Count: 392
Status: Offline
Project Badges:
Reply to this Post  Reply with Quote 
Re: New BETA test - Oct 6, 2014 [ Issues Thread ]

Mamajuanauk: Does your graphics window only display the progress bar and a number counting up or does the window close almost immediately after you click 'show graphics'? If it closes immediately, it may be related a bug with the boinc api that reported in a different thread a couple of months ago. As a work around, you can launch the boinc gui as a user who is in the boinc group (show graphics for MCM1 behaves the same way).

Seippel
[Oct 11, 2014 7:14:20 PM]   Link   Report threatening or abusive post: please login first  Go to top 
Crystal Pellet
Veteran Cruncher
Joined: May 21, 2008
Post Count: 1324
Status: Offline
Project Badges:
Reply to this Post  Reply with Quote 
Re: New BETA test - Oct 6, 2014 [ Issues Thread ]

There is no date I can share with you unfortunately. As usual with most projects we attempt to keep the launch date private.

Thanks,
-Uplinger

But the subject of the project you may share. It's not hard to guess seeing passing by all those sequences, that it will be a gene or protein project.

atgaaaaaatttaatgttcaaatcacatacactggcatgattgaagagactatcgaggctgaaagtttagacgaagcagaaaatgaggcgcatgatattg
cgagaatggaagtgccatttgattgtgatgagtatgaaatttatgtagatgtggagcaggaaaatgactaa
[Oct 11, 2014 7:18:07 PM]   Link   Report threatening or abusive post: please login first  Go to top 
Mamajuanauk
Master Cruncher
United Kingdom
Joined: Dec 15, 2012
Post Count: 1900
Status: Offline
Project Badges:
Reply to this Post  Reply with Quote 
Re: New BETA test - Oct 6, 2014 [ Issues Thread ]

Mamajuanauk: Does your graphics window only display the progress bar and a number counting up or does the window close almost immediately after you click 'show graphics'? If it closes immediately, it may be related a bug with the boinc api that reported in a different thread a couple of months ago. As a work around, you can launch the boinc gui as a user who is in the boinc group (show graphics for MCM1 behaves the same way).

Seippel
Nothing comes up, no window at all...

However, this is on a server with a basic onboard gpu, so that may have something to do with it... (Boinc 7.0.27)

On a different machine running Ubuntu 14.xx (desktop) Boinc 7.2.42 the window opens then closes immediately

I checked on my Windows machine, it does display the window with only the counter bar and WCG logo.
----------------------------------------
Mamajuanauk is the Name! Crunching is the Game!



[Oct 11, 2014 7:49:00 PM]   Link   Report threatening or abusive post: please login first  Go to top 
Crystal Pellet
Veteran Cruncher
Joined: May 21, 2008
Post Count: 1324
Status: Offline
Project Badges:
Reply to this Post  Reply with Quote 
Re: New BETA test - Oct 6, 2014 [ Issues Thread ]

Meanwhile most of my BETA's returned without issues.
Only the tasks of the 00032-batch are still in progress with longer runtimes of ~8-9 hours.

The maximum result.tmp I observed was 6,957,830 bytes and upload files between 250-270kB.
[Oct 11, 2014 8:58:32 PM]   Link   Report threatening or abusive post: please login first  Go to top 
Former Member
Cruncher
Joined: May 22, 2018
Post Count: 0
Status: Offline
Reply to this Post  Reply with Quote 
Re: New BETA test - Oct 6, 2014 [ Issues Thread ]

I'm running Ubuntu 14.04 LTS Desktop code on an IBM 3650 M2 server with Boinc client 7.4.12 and it works OK.. Get black screen with logo at the bottom and white progress bar.
----------------------------------------
[Edit 1 times, last edit by Doneske at Oct 11, 2014 9:24:13 PM]
[Oct 11, 2014 9:23:07 PM]   Link   Report threatening or abusive post: please login first  Go to top 
uplinger
Former World Community Grid Tech
Joined: May 23, 2005
Post Count: 3952
Status: Offline
Project Badges:
Reply to this Post  Reply with Quote 
Re: New BETA test - Oct 6, 2014 [ Issues Thread ]

We are sending out a random sampling from about 50 batches for this beta. There will be 5,700 work units sent out with a quorum of two. No update to the science application is needed for this test, as it is to help check the estimator.

Thanks,
-Uplinger
[Oct 12, 2014 7:17:12 PM]   Link   Report threatening or abusive post: please login first  Go to top 
Falconet
Master Cruncher
Portugal
Joined: Mar 9, 2009
Post Count: 3295
Status: Offline
Project Badges:
Reply to this Post  Reply with Quote 
Re: New BETA test - Oct 6, 2014 [ Issues Thread ]

Got 4 of the new ones.

Going really fast, some at 10% after 1 and a half CPU minute.
----------------------------------------


AMD Ryzen 5 1600AF 6C/12T 3.2 GHz - 85W
AMD Ryzen 5 2500U 4C/8T 2.0 GHz - 28W
AMD Ryzen 7 7730U 8C/16T 3.0 GHz
----------------------------------------
[Edit 1 times, last edit by Falconet at Oct 12, 2014 7:32:13 PM]
[Oct 12, 2014 7:31:29 PM]   Link   Report threatening or abusive post: please login first  Go to top 
vepaul
Senior Cruncher
Belgium
Joined: Nov 17, 2004
Post Count: 261
Status: Offline
Project Badges:
Reply to this Post  Reply with Quote 
Re: New BETA test - Oct 6, 2014 [ Issues Thread ]

Mine look fine, all of about the same length

BETA_ ugm1_ ugm1_ 00031_ 1161_ 0-- 722 Valide 11/10/14 14:40:09 11/10/14 20:01:21 3,01 90,4 / 80,6
BETA_ ugm1_ ugm1_ 00031_ 1161_ 1-- 722 Valide 11/10/14 14:40:08 11/10/14 22:51:20 5,33 70,8 / 80,6

VEP
[Oct 12, 2014 8:12:50 PM]   Link   Report threatening or abusive post: please login first  Go to top 
Crystal Pellet
Veteran Cruncher
Joined: May 21, 2008
Post Count: 1324
Status: Offline
Project Badges:
Reply to this Post  Reply with Quote 
Re: New BETA test - Oct 6, 2014 [ Issues Thread ]

All tasks received where BOINC-data is on a RAM-disk, crash directly after the start.
CEP2's are running fine from that folder.

ERROR: could not initialize graphics pointer in shared memory.

BETA_ betaugm1_ ugm1_ 00036_ 0303_ 0-- 3166874 Error 10/12/14 20:12:16 10/12/14 20:13:37 0.00 / 0.00 0.0 / 0.0
BETA_ betaugm1_ ugm1_ 00036_ 0291_ 0-- 3166874 Error 10/12/14 20:12:16 10/12/14 20:13:37 0.00 / 0.00 0.0 / 0.0
BETA_ betaugm1_ ugm1_ 00036_ 0219_ 0-- 3166874 Error 10/12/14 20:12:16 10/12/14 20:13:37 0.00 / 0.00 0.0 / 0.0
BETA_ betaugm1_ ugm1_ 00036_ 0147_ 1-- 3166874 Error 10/12/14 20:12:16 10/12/14 20:13:37 0.00 / 0.00 0.0 / 0.0
BETA_ betaugm1_ ugm1_ 00032_ 0601_ 1-- 3166874 Error 10/12/14 19:51:07 10/12/14 19:56:34 0.00 / 0.00 0.0 / 0.0
[Oct 12, 2014 8:20:36 PM]   Link   Report threatening or abusive post: please login first  Go to top 
KWSN - A Shrubbery
Master Cruncher
Joined: Jan 8, 2006
Post Count: 1585
Status: Offline
Reply to this Post  Reply with Quote 
Re: New BETA test - Oct 6, 2014 [ Issues Thread ]

Looking good. Already returned some of the faster ones.
----------------------------------------

Distributed computing volunteer since September 27, 2000
[Oct 12, 2014 8:31:01 PM]   Link   Report threatening or abusive post: please login first  Go to top 
Posts: 148   Pages: 15   [ Previous Page | 4 5 6 7 8 9 10 11 12 13 | Next Page ]
[ Jump to Last Post ]
Post new Thread