| Index | Recent Threads | Unanswered Threads | Who's Active | Guidelines | Search |
 |
World Community Grid Forums
Category: Completed Research
Forum: Help Cure Muscular Dystrophy - Phase 2 Forum
Thread: DMD |
| No member browsing this thread |
|
Thread Status: Active Total posts in this thread: 3
|
|
| Author |
|
|
Former Member
Cruncher Joined: May 22, 2018 Post Count: 0 Status: Offline |
Is the muscular dystrophy research here being done on Duchenne muscular dystrophy or all MD's? In biology, my group decoded a DNA sequence and transcribed it to RNA, and the codons showed a mutation for this disease, I was wondering if they were correlated?
DNA = TACTTTTTATAGTACCGACCTAACGTTGTTTGGTTGTCACTTTTC RNA = AUG AAA AAU AUC AUG GCU GGA UUG CAA CAA ACC AAC AGU GAA AAG Which codes for MKNIMAGLQQTNSEK Looking this up in the Protein-Protein Blast yields results in a dystrophin mutation result. Is this the specific mutation the project is trying to cure, or is there a different cause? |
||
|
|
sk..
Master Cruncher http://s17.rimg.info/ccb5d62bd3e856cc0d1df9b0ee2f7f6a.gif Joined: Mar 22, 2007 Post Count: 2324 Status: Offline Project Badges: 
|
I think this is more of a theoretical docking project, but I don't know what exact protein receptor sequences have been used. It's a given that the scientists involved do other in-house research into MD, and possibly several types.
You might be able to find out more yourself if you read the literature here. |
||
|
|
Former Member
Cruncher Joined: May 22, 2018 Post Count: 0 Status: Offline |
Hello PseudoOne,
----------------------------------------Here is Dr. Carbone's description of HCMD: https://secure.worldcommunitygrid.org/forums/...ead,30785_offset,0#312380 Here is my own description of what it means (in part)  https://secure.worldcommunitygrid.org/forums/...ead,30616_offset,0#308159 Search for posts by Alessandra Carbone and you will find a lot more of interest. In short, we are trying to find a lot of the interacting proteins that are affected by muscular dystrophy (Duchenne and other types) in the hope that this will inspire someone to develop a way to intervene medically. At the very least, we hope to provide a basis to help additional research to characterize how muscular dystrophy works, which may "inspire someone to develop a way to intervene medically". This is basic research, but it is targeted against all kinds of muscular dystrophy. Lawrence [Edit 1 times, last edit by Former Member at Mar 31, 2011 2:03:53 PM] |
||
|
|
|